CuradoriaFitossanidade
0

Marcadores para as principais pragas da agricultura brasileira

Curadoria Agro Insight

Já pensou em ter disponível marcadores genéticos e morfológicos que permitam identificar precisamente as principais pragas das lavouras brasileiras?

Pois é o que promete esse achado da internet descoberto pela nossa curadoria!

Vocês já ouviram falar do NaturaeData?

O naturaedata.com.br é uma página web que iniciou em 2020 com um projeto que está mapeando e disponibilizando em livre acesso, um banco de dados genético, morfológicos e fotográficos de espécies praga regionais.

Atualmente não existem informações locais disponíveis, embora iniciativas globais de sequenciamento massivo de DNA da biodiversidade venham sendo desenvolvidas por diversos grupos de pesquisa mundiais. Além disso, não existe a integração das informações morfológicas, utilizadas para identificação das espécies, com os dados de sequências genéticas.

Objetivo da NaturaeData

Criar um banco de dados confiável, com informações genéticas, morfológicas e de imagem de diversas pragas regionais da agricultura.

A proposta inédita do NaturaeData é ter um marcador molecular para cada espécie associado  a uma fotografia do animal, e imagem em detalhe da principal estrutura diagnóstica da espécie, o que proporcionará confiabilidade a base de dados e permitirá a confirmação da identificação em nível específico por qualquer pessoa.

EXEMPLO

ESPÉCIE

Loxa deducta (Walker, 1867)

Espécie praga secundária de várias culturas, especialmente a soja. Amplamente encontrada em Ligustrum e recentemente registrada causando danos em frutos de noz-pecan.

Nome comum: percevejo-verde

 

 

 

 

 

DNA

CTCGGATTTTATTTTCTTATTTGAGTATATAAGCTGAGGATAGTAGGGTCCGCAATA

AGACTAATTATCCGAATTGAATTAGGTCATCCTGGAAGATTCATTGGAGATGATCAA

ATTTATAATGTAATCGTTACAGCTCACGCATTTGTAATAATCTTTTTTATAGTTATACC

TATTATAATTGGAGGTTTCGGTAATTGATTGGTACCTTTAATAATTGGAGCTCCTGAT

ATAGCATTTCCTCGTATAAATAATATAAGATTTTGGCTTTTACCCCCTTCATTAACTC

TTTTAATAGTAAGAAGACTTACAGAATCAGGAGCCGGAACAGGATGAACAGTTTATC

CCCCTTTATCAAGTAATTTATCCCATAGAGGTGCATCGGTAGACTTAGCAATCTTTT

CTCTACATCTAGCAGGAGTATCATCAATCTTAGGAGCTGTAAATTTTATCTCAACAAT

TATAAATATACGTCCTACAGGAATAATTCCTGAACGGATTCCTTTATTTGTATGATCA

GTAGGAATTACAGCCTTATTATTATTGTTATCATTACCAGTATTAGCTGGAGCTATTA

CAATATTATTAACAGACCGAAACTTTAATACATCATTCTTTGATCCTTCAGGAGGGG

GAGACCCTATTCTTTATCAACATTTATTCTGATTTTTTGGTCACCGGAAAGTTTAAA

 

TAMANHO

Macho 13,3-16,3 mm Fêmea 16,3-19,4 mm

 

COLORAÇÃO

Coloração verde quando vivos, com pontuações avermelhadas na cabeça, em faixas submarginais nas placas mandibulares. Ângulos umerais desenvolvidos em espinhos

 

PLANTA HOSPEDEIRA

Soja, Citrus sp., pata de vaca aroeira cinzenta, aroeira mansa, branquilho, joá, ligustro, tipa. noz-pecan.

 

DANOS

soja, ligustrum, noz-pecan

 

DISTRIBUIÇÃO

Panamá, Venezuela, Bolivia, Brasil (MA, CE, PE, AL, RJ, SP, PR, RS), Chile, Argentina, Paraguai, Uruguai.

Considerações

Os primeiros dados (genéticos e morfológicos) já revelam os principais percevejos pragas mais comuns nas lavouras. Em breve o site promete expor novas análises de mariposas e roedores, o material é de fácil acesso e ótima leitura.

Vale apena conferir.

A NaturaData é uma iniciativa privada com parceria pública.

Espaço para parceiros do Agro aqui

Tags: , , ,

Posts Relacionados

Deixe um comentário

O seu endereço de e-mail não será publicado.

Preencha esse campo
Preencha esse campo
Digite um endereço de e-mail válido.
Você precisa concordar com os termos para prosseguir

agosto 2022
D S T Q Q S S
 123456
78910111213
14151617181920
21222324252627
28293031  
LinkedIn
YouTube
Instagram
Menu